[ CAS No. 60444-78-2 ] {[proInfo.proName]}

Name: 60444-78-2|2,5-Dioxopyrrolidin-1-yl 4-formylbenzoate|97%
Brand: Ambeed
SKU: A355420
Price: 5.0 USD
Availability: InStock
Rating: 98 (26 reviews)

,{[proInfo.pro_purity]}

Cat. No.: {[proInfo.prAm]}

2D 3D

Structure of 60444-78-2 * Storage: {[proInfo.prStorage]}

Cart0 Add to My Favorites Add to My Favorites Bulk Inquiry Inquiry Add To Cart

Search after Editing

* Storage: {[proInfo.prStorage]}

For Research Only 110K+ Compounds Competitive Price 1-2 Day Shipping

Quality Control of [ 60444-78-2 ]

COA NMR CNMR HPLC LC-MS

Related Doc. of [ 60444-78-2 ]

SDS Specification

Alternatived Products of [ 60444-78-2 ]

Product Details of [ 60444-78-2 ]

CAS No. :	60444-78-2	MDL No. :	MFCD00133733
Formula :	C₁₂H₉NO₅	Boiling Point :	-
Linear Structure Formula :	-	InChI Key :	VHYRHFNOWKMCHQ-UHFFFAOYSA-N
M.W :	247.20	Pubchem ID :	4126130
Synonyms :	Succinimidyl 4-formylbenzoate;SFB;Succinimidyl p-formylbenzoate	Chemical Name :	2,5-Dioxopyrrolidin-1-yl 4-formylbenzoate

Calculated chemistry of [ 60444-78-2 ]

Physicochemical Properties

Num. heavy atoms :	18
Num. arom. heavy atoms :	6
Fraction Csp3 :	0.17
Num. rotatable bonds :	4
Num. H-bond acceptors :	5.0
Num. H-bond donors :	0.0
Molar Refractivity :	62.63
TPSA :	80.75 Å²

Pharmacokinetics

GI absorption :	High
BBB permeant :	No
P-gp substrate :	No
CYP1A2 inhibitor :	No
CYP2C19 inhibitor :	No
CYP2C9 inhibitor :	No
CYP2D6 inhibitor :	No
CYP3A4 inhibitor :	No
Log Kp (skin permeation) :	-7.56 cm/s

Lipophilicity

Log Po/w (iLOGP) :	1.43
Log Po/w (XLOGP3) :	0.35
Log Po/w (WLOGP) :	0.34
Log Po/w (MLOGP) :	0.74
Log Po/w (SILICOS-IT) :	1.23
Consensus Log Po/w :	0.82

Druglikeness

Lipinski :	0.0
Ghose :	None
Veber :	0.0
Egan :	0.0
Muegge :	0.0
Bioavailability Score :	0.55

Water Solubility

Log S (ESOL) :	-1.58
Solubility :	6.56 mg/ml ; 0.0266 mol/l
Class :	Very soluble
Log S (Ali) :	-1.61
Solubility :	6.07 mg/ml ; 0.0245 mol/l
Class :	Very soluble
Log S (SILICOS-IT) :	-2.26
Solubility :	1.35 mg/ml ; 0.00545 mol/l
Class :	Soluble

Medicinal Chemistry

PAINS :	0.0 alert
Brenk :	2.0 alert
Leadlikeness :	1.0
Synthetic accessibility :	1.99

Safety of [ 60444-78-2 ]

Signal Word:	Warning	Class:	N/A
Precautionary Statements:	P261-P305+P351+P338	UN#:	N/A
Hazard Statements:	H302-H315-H319-H335	Packing Group:	N/A
GHS Pictogram:

Application In Synthesis of [ 60444-78-2 ]

* All experimental methods are cited from the reference, please refer to the original source for details. We do not guarantee the accuracy of the content in the reference.

Downstream synthetic route of [ 60444-78-2 ]

[ 60444-78-2 ] Synthesis Path-Downstream 1~49

1
[ 109-97-7 ]
[ 487-68-3 ]
[ 60444-78-2 ]
5,10,15-trimesityl-20-<4-(succinimidyloxycarbonyl)phenyl>porphyrin [ No CAS ]

Reference： [1]Tetrahedron,1994,vol. 50,p. 8941 - 8968

2
[ 60444-78-2 ]
5\-d(GAGTCCAATTCGTACC)-P(O)(OH)OCH₂CH(CH₂OH)(CH₂)4NH₂ [ No CAS ]
5\-d(GAGTCGAATTCGTACC)-P(O)(OH)OCH₂CH(CH₂OH)(CH₂)4NHC(O)-(p-C₆H₄CHO) [ No CAS ]

Reference： [1]Angewandte Chemie - International Edition,2002,vol. 41,p. 1796 - 1800

3
[ 60444-78-2 ]
3\-d(AGGGCTCAGCTTAAGCATGG)-5\-CH₂OCH₂NH₂ [ No CAS ]
HCO-p-C₆H₄-C(O)NHCH₂OCH₂-5\-d(GGTACGAATTCGACTCGGGA) [ No CAS ]

Reference： [1]Angewandte Chemie - International Edition,2002,vol. 41,p. 1796 - 1800

4
[ 24871-47-4 ]
[ 60444-78-2 ]
4-{6-[9-(4-benzyloxycarbonyloxy-3,5-dimethoxy-phenyl)-8-oxo-5,5a,6,8,8a,9-hexahydro-furo[3',4':6,7]naphtho[2,3-d][1,3]dioxol-5-yloxy]-7,8-dihydroxy-hexahydro-pyrano[3,2-d][1,3]dioxin-2-yl}-benzoic acid 2,5-dioxo-pyrrolidin-1-yl ester [ No CAS ]

Reference： [1]Biochemical Pharmacology,1997,vol. 53,p. 715 - 722

5
[ 6066-82-6 ]
[ 619-66-9 ]
[ 60444-78-2 ]

Yield	Reaction Conditions	Operation in experiment
85%	With 1-ethyl-(3-(3-dimethylamino)propyl)-carbodiimide hydrochloride; In N,N-dimethyl-formamide; at 20℃; for 16h;	To a solution of 4-Formylbenzoic acid (1.00 g, 6.66 mmol) in DMF (30 mL) were added EDC-HC1 (1.40 g, 7.33 mmol) and N-hydroxysuccinimid (842 mg, 7.33 mmol). After stirring for 16 h at room temperature the mixture was diluted with EtOAc (150 mL) and washed with sat. aq. NaCl solution (3 x 50 mL). The organic phase was dried over Na2S04 and the solvent removed affording the desired product (1.40 g, 5.66 mmol, 85 %) as a colorless solid. (0218) 1H NMR (CHLOROFORM-d, 400 MHz): delta = 10.13 (s, 1H), 8.21-8.37 (m, 3H), 7.96-8.07 (m, 3H), 2.93 ppm (d, J = 8.7 Hz, 6H)
53%	With dmap; dicyclohexyl-carbodiimide; In dichloromethane; N,N-dimethyl-formamide; for 12h;	4-Carboxybenzaldehyde (5 g, 0.033 mol) was dissolvedin mixture CH2Cl2 and dimethyl formamide (DMF) (50 ml,50 ml). N-Hydroxysuccinimide 3.83 g (0.033 mol) wasadded. Then 7.43 g (0.036 mol) of dicyclohexylcarbodiimide(DCC) and a catalytic amount of dimethylaminopyridine(DMAP) were added. The reaction was carried out for 12 h.The precipitate was filtered off. The filtrate was washed by5% acetic acid (250 ml), 5% NaOH solution (250 ml) anddistilled water (3*50 ml) successively. The organic layer wasdried over anhydrous Na2SO4, purified by chromatographyon silica gel, eluent - CHCl3. The product is finely dispersedwhite powder. Yield: 4.44 g (53 %). Tmp = 168oC. IR spectrum,nu, cm-1: 2936 w (CHar), 2849, 2819 w (CH2), 2720,2650 w (CHO), 1792-1705 s (C=O), 1214, 1204 s (COH).1H NMR spectrum (CDCl3), delta, ppm: 2.94 s (4H, CH2), 8.02d (2H, CHar, JHH 7.9 Hz), 8.29 d (2H, CHar, JHH 7.9 Hz),10.14 s (1H, COH). 13C NMR spectrum (CDCl3), deltaC, ppm:25.4, 129.4, 130.9, 140.1, 160.8, 168.7, 190.9. Mass spectrum,m/z (I, %): 248 (20) [M]+, Found, %: C 57.67; H 4.61;N 6.67; O 31.05. C12H9NO5. Calculated, %: C 58.31; H 3.67;N 5.66; O 32.36.
	With N-(3-dimethylaminopropyl)-N-ethylcarbodiimide; In dimethyl sulfoxide; for 2h;	The preparation of the Step 3 Bispecific Reagent (FIG. 38) involves the addition of a small organic molecule, 4-carboxybenzaldehyde 5330, which bears a reactive organic functional group, an aldehyde group, as the isotope trapping moiety of the Step 3 Bispecific Reagent, to some of the amino acid residues on the enzyme ornithine decarboxylase 5332, the targeting moiety of the Step 3 Bispecific Reagent, without affecting the enzymatic activity of the enzyme. Terephthalaldehydic acid (4-carboxybenzaldehyde 5330) is dissolved in dimethylsulfoxide and activated with N-hydroxysuccinimide and 1-ethyl-3-[3-(dimethylamino)propyl] carbodiimide for 2 hours to yield 5331. Ornithine decarboxylase is dissolved in phosphate buffer, pH 7.2, and the reaction mixture containing activated 4-carboxybenzaldehyde 5331 is added in 100 muL portions while maintaining the pH of the reaction between 7 and 7.5 with 1N sodium hydroxide. Following the reaction, the protein solution is dialyzed at 4 C. in phosphate buffered saline, pH 6.5, to remove low molecular weight reagents.

With 1-ethyl-(3-(3-dimethylamino)propyl)-carbodiimide hydrochloride; In dichloromethane; at 20℃;

Synthesis4-Formylbenzoic acid NHSThe NHS-ester product was synthesized by mixing 4-formylbenzoic acid with 1.1 eq.EDC?HCI (N-(3-dimethylaminopropyl)-N?-ethylcarbodiimide hydrochloride) and 1.1 eq. Nhydroxysuccinimide in a solution comprising dichloromethane (DCM) at room temperature(rt), which resulted in formation of an NHS-ester product (see scheme 2):

Reference： [1]Angewandte Chemie - International Edition,2012,vol. 51,p. 6144 - 6148
[2]Chemical Communications,2012,vol. 48,p. 5322 - 5324
[3]ChemPlusChem,2014,vol. 79,p. 90 - 98
[4]Molecular Pharmaceutics,2018,vol. 15,p. 4161 - 4172
[5]Patent: WO2018/189214,2018,A1 .Location in patent: Page/Page column 38
[6]Angewandte Chemie - International Edition,2019,vol. 58,p. 3542 - 3547
Angew. Chem.,2019,vol. 58,p. 3542 - 3547,6
[7]Journal of the American Chemical Society,2016,vol. 138,p. 3190 - 3201
[8]Letters in Organic Chemistry,2016,vol. 13,p. 718 - 725
[9]Journal of the American Chemical Society,2012,vol. 134,p. 11392 - 11395
[10]Bioorganic and Medicinal Chemistry Letters,2005,vol. 15,p. 1229 - 1233
[11]Patent: US2006/18908,2006,A1 .Location in patent: Page/Page column 21
[12]Angewandte Chemie - International Edition,2007,vol. 46,p. 7297 - 7300
[13]Journal of the American Chemical Society,2009,vol. 131,p. 9189 - 9191
[14]Chemical Communications,2011,vol. 47,p. 893 - 895
[15]Chemical Communications,2013,vol. 49,p. 5366 - 5368
[16]Chemical Communications,2014,vol. 50,p. 10997 - 10999
[17]Patent: WO2016/5474,2016,A1 .Location in patent: Page/Page column 59
[18]Organic and Biomolecular Chemistry,2016,vol. 14,p. 3715 - 3728

6
[ 60444-78-2 ]
[ 156-87-6 ]
4-formyl-N-(3-hydroxy-propyl)-benzamide [ No CAS ]

Reference： [1]Bioorganic and Medicinal Chemistry Letters,2005,vol. 15,p. 1229 - 1233

7
ornithine decarboxylase [ No CAS ]
[ 60444-78-2 ]
ornithine decarboxylase modified with 4-carboxybenzaldehyde [ No CAS ]

Yield	Reaction Conditions	Operation in experiment
		The preparation of the Step 3 Bispecific Reagent (FIG. 38) involves the addition of a small organic molecule, 4-carboxybenzaldehyde 5330, which bears a reactive organic functional group, an aldehyde group, as the isotope trapping moiety of the Step 3 Bispecific Reagent, to some of the amino acid residues on the enzyme ornithine decarboxylase 5332, the targeting moiety of the Step 3 Bispecific Reagent, without affecting the enzymatic activity of the enzyme. Terephthalaldehydic acid (4-carboxybenzaldehyde 5330) is dissolved in dimethylsulfoxide and activated with N-hydroxysuccinimide and 1-ethyl-3-[3-(dimethylamino)propyl] carbodiimide for 2 hours to yield 5331. Ornithine decarboxylase is dissolved in phosphate buffer, pH 7.2, and the reaction mixture containing activated 4-carboxybenzaldehyde 5331 is added in 100 muL portions while maintaining the pH of the reaction between 7 and 7.5 with 1N sodium hydroxide. Following the reaction, the protein solution is dialyzed at 4 C. in phosphate buffered saline, pH 6.5, to remove low molecular weight reagents.

Reference： [1]Patent: US2006/18908,2006,A1 .Location in patent: Page/Page column 21

8
carboxyl-polyethylene glycol-amine [ No CAS ]
[ 60444-78-2 ]
carboxy-PEG-benzaldehyde [ No CAS ]

Yield	Reaction Conditions	Operation in experiment
	With phosphate buffer; In dimethyl sulfoxide; at 20℃; for 4h;pH 7.5;	In a 25-mL round bottomed flask, 500 mg of carboxyl-polyethylene glycol-amine (0.147 mmole) (Shearwater) was diluted with 25 ml of 10 mM phosphate buffer, pH 7.5. To the resulting solution was added 49.42 mg of N-hydroxysuccinimidyl-formylbenzoate (Solulink) which had been dissolved in dimethyl sulfoxide. The resulting reaction was stirred at room temperature under argon in the dark. After 4 hours, the aqueous phase was extracted with dichloromethane (DCM). The DCM phase was dried over MgSO4 and concentrated under reduced pressure to provide a residual liquid which was extracted with ether (3×50 mL). Carboxy-PEG-benzaldehyde (CPB) was precipitated by adding cold isopropyl alcohol (IPA) to the combined ethereals. The precipitate was then washed with cold IPA then dissolved in 8 ml of DCM. To the resulting solution was added 0.8 ml of 10% of sodium phosphate buffer at pH 5.0, followed by 150 mg of(1-ethyl-3-(3-dimethylamino propyl)carbodiimide (EDC), and 102 mg of N-hydroxysuccinimide (NHS). The resulting reaction was stirred under argon for 2 hours, the DCM phase was collected, dried over MgSO4 and concentrated in vacuo to provide an oily residue which was washed using IPA and dried in vacuo to provide compound 1 (yield=238 mg). The molecular weight of PEG is 3400 Da The residual carboxyl group in the intermediate product was completely converted to the final product by another reaction with EDC and NHS. For instance, 50 mg of the intermediate product was dissolved in 2.5 ml of ethyl acetate. 16.11 mg of NHS and 28.475 mg of EDC were added. The reaction mixture was stirred for 1.5 hours under Argon. The reaction mixture was concentrated down to a colorless gumlike material. Two ml of ether was added to allow a precipitate to form. Ether was decanted and the residue was washed with ether for two more times. A solid material (23 mg) was collected as the final product. The compound was analyzed on a thin layer chromatography plate and was obeserved as a distinct spot. The ultraviolet spectrum of the final product was identical to NHS-benzaldehyde. This compound (N-hydroxy-succinimidyl-polyethylene glycol-Benzaldehyde) hereafter will be referred to as PBA and has Formula I. N-hydroxy-succinimidyl-polyethylene glycol-Benzaldehyde) (PBA) (1)
	In dimethyl sulfoxide; at 20℃; for 4h;pH 7.5;	In a 25-mL round bottomed flask, 500 mg of carboxyl-polyethylene glycol- amine (0.147 mmole) (Shearwater) was diluted with 25 ml of 10 mM phosphate buffer, pH 7.5. To the resulting solution was added 49.42 mg of N-hydroxysuccinimidyl- formylbenzoate (Solulink) which had been dissolved in dimethyl sulfoxide. The resulting reaction was stirred at room temperature under argon in the dark. After 4 hours, the aqueous phase was extracted with dichloromethane (DCM). The DCM phase was dried over MgSO4 and concentrated under reduced pressure to provide a residual liquid which was extracted with ether (3 x 50 mL). Carboxy-PEG-benzaldehyde (CPB) was precipitated by adding cold isopropyl alcohol (IPA) to the combined ethereals. The precipitate was then washed with cold IPA then dissolved in 8 ml of DCM. To the resulting solution was added 0.8 ml of 10% of sodium phosphate buffer at pH 5.0, followed by 150 mg of (l-ethyl-3-(3-dimethylamino propyl)carbodiimide (EDC), and 102 mg of N-hydroxysucciiiimide (NHS). The resulting reaction was stirred under argon for 2 hours, the DCM phase was collected, dried over MgSO4 and concentrated in vacuo to provide an oily residue which was washed using IPA and dried in vacuo to provide the compound (yield = 238 mg). The molecular weight of PEG is 3400 Da.The residual carboxyl group in the intermediate product was completely converted to the final product by another reaction with EDC and NHS. For instance, 50 mg of the intermediate product was dissolved in 2.5 ml of ethyl acetate. 16.11 mg of NHS and 28.475 mg of EDC were added. The reaction mixture was stirred for 1.5 hours under Argon. The reaction mixture was concentrated down to a colorless gumlike material. Two ml of ether was added to allow a precipitate to form. Ether was decanted and the residue was washed with ether for two more times. A solid material (23 mg) was collected as the final product. The compound was analyzed on a thin layer chromatography plate and was obeserved as a distinct spot. The ultraviolet spectrum of the final product was identical to NHS-benzaldehyde. This compound (N-hydroxy- succinimidyl-polyethylene glycol-Benzaldehyde) is referred to as PBA and has Formula HL supra.

Reference： [1]Patent: US2006/153839,2006,A1 .Location in patent: Page/Page column 28-29
[2]Patent: WO2007/97934,2007,A2 .Location in patent: Page/Page column 65

9
DNA, single stranded, 5'-d(TTCGTCATTCCGTTTCT)-OP(O)(OH)-OCH₂CH(CH₂OH)(CH₂)4NH₂ [ No CAS ]
[ 60444-78-2 ]
DNA, single stranded, 5'-d(TTCGTCATTCCGTTTCT)-OP(O)(OH)-OCH₂CH(CH₂OH)(CH₂)4NHC(O)(4-C(O)H-C₆H₄) [ No CAS ]

Reference： [1]Angewandte Chemie - International Edition,2007,vol. 46,p. 7297 - 7300

10
[ 152274-67-4 ]
[ 60444-78-2 ]
C₅₂H₇₀N₁₂O₉S₂ [ No CAS ]

Reference： [1]Analytical Chemistry,2009,vol. 81,p. 4864 - 4872

11
[ 1234476-64-2 ]
[ 60444-78-2 ]
C₄₃H₆₈N₁₄O₁₂ [ No CAS ]

Reference： [1]Analytical Chemistry,2009,vol. 81,p. 4864 - 4872

12
Ahx-Pro₉Gly₂His₆ [ No CAS ]
[ 60444-78-2 ]
[ 1236280-40-2 ]

Reference： [1]Journal of the American Chemical Society,2010,vol. 132,p. 10027 - 10033

13
[ 1254054-74-4 ]
[ 60444-78-2 ]
[ 1254054-75-5 ]

Reference： [1]Organic and Biomolecular Chemistry,2010,vol. 8,p. 4329 - 4345

14
[ 105832-38-0 ]
[ 619-66-9 ]
[ 60444-78-2 ]

Reference： [1]Organic and Biomolecular Chemistry,2010,vol. 8,p. 4329 - 4345

15
[ 625-82-1 ]
[ 60444-78-2 ]
[ 1266617-61-1 ]

Reference： [1]Chemical Communications,2011,vol. 47,p. 893 - 895

16
[ 1314043-15-6 ]
[ 60444-78-2 ]
[ 1314043-16-7 ]

Yield	Reaction Conditions	Operation in experiment
37%	In water; acetonitrile; for 1h;pH 7.2;aq. phosphate buffer;	Amino-DOTA (5, 100 mg, 191 mumol) and SFB (52 mg, 211 mumol) were dissolved in a mixture of phosphate buffer (0.1 M, pH 6, 350 muL) and MeCN (350 muL) and the pH was adjusted to 7.2 by adding phosphate buffer (0.5 M, pH 7.2, 200 muL). After 60 min, the reaction mixture was acidified by using 1 M HCl and the crude product was purified by semi-preparative HPLC with 0-40% MeCN + 0.1% TFA in 8 min as the gradient (Rt = 3.2 min). The product was obtained as white, highly hygroscopic solid after lyophilization (46 mg, 70 mumol, 37% yield).1H NMR (500 MHz, DMSO-d6, 25 C, TMS): delta = 10.09 (s, 1H); 9.35 (t, 1H, 3J(H,H) = 6.0 Hz); 8.97 (br s, 1H); 8.09-8.07 (m, 2H); 8.02-8.00 (m, 2H); 7.32-7.31 (m, 2H); 7.28-7.26 (m, 2H); 4.48 (br d, 2H, 3J(H,H) = 5.9 Hz); 4.32 (br d, 2H, 3J(H,H) = 5.5 Hz); 4.01 (br s, 2H); 3.94 (br s, 2H); 3.63 (br s, 4H); 3.33 (br s, 8H); 3.12 (br s, 8H). 13C NMR (125 MHz, DMSO-d6, 25 C, TMS): delta = 192.84; 165.29; 158.13; 157.87; 139.24; 138.20; 137.73; 136.91; 129.36; 127.89; 127.49; 127.31; 54.60; 54.58; 53.89; 53.86; 52.79; 52.77; 52.76; 50.50; 50.48; 50.46; 50.33; 50.31; 48.53; 48.51; 48.49; 48.42; 48.39; 42.46; 42.05. ESI-MS (m/z) for [M+H]+ (calculated): 655.31 (655.30).

Reference： [1]Bioorganic and Medicinal Chemistry,2011,vol. 19,p. 3864 - 3874

17
[ 60444-78-2 ]
N-(2-aminoethyl)maleimide trifluoroacetate [ No CAS ]
[ 1314043-26-9 ]

Yield	Reaction Conditions	Operation in experiment
55%	In water; acetonitrile; for 1h;pH 7.2;aq. phosphate buffer;	To a solution of N-(2-aminoethyl)maleimide trifluoroacetate salt (15.4 mg, 60.7 mumol) in a mixture of phosphate buffer (0.1 M, pH 6, 250 muL) and MeCN (250 muL) was added <strong>[60444-78-2]p-formylbenzoic acid N-hydroxysuccinimide ester</strong> (SFB, 15.0 mg, 60.7 mumol) and the pH of the mixture was adjusted to 7.2 by adding phosphate buffer (0.5 M, pH 7.2, 100 muL). After 60 min, the reaction mixture was acidified by using 1 M HCl and the crude product was purified by semi-preparative HPLC with 0-40% MeCN + 0.1% TFA in 8 min as the gradient (Rt = 3.2 min). The product was obtained as white solid after lyophilization (9 mg, 33 mumol, 55% yield).1H NMR (500 MHz, DMSO-d6, 25 C, TMS): delta = 10.07 (s, 1H); 8.81 (t, 1H, 3J(H,H) = 6.0 Hz); 8.00-7.98 (m, 2H); 7.92-7.90 (m, 2H); 7.02 (s, 2H); 3.61-3.59 (m, 2H); 3.45-3.41 (m, 2H). 13C NMR (125 MHz, DMSO-d6, 25 C, TMS): delta = 192.80; 171.03; 165.66; 139.35; 137.62; 134.46; 129.31; 127.70; 37.66; 36.96. ESI-MS (m/z) for [M+H]+ (calculated): 273.09 (273.08).

Reference： [1]Bioorganic and Medicinal Chemistry,2011,vol. 19,p. 3864 - 3874

18
[ 60444-78-2 ]
[ 161552-03-0 ]
[ 1261036-91-2 ]

Reference： [1]ChemBioChem,2010,vol. 11,p. 2168 - 2181

19
[ 60444-78-2 ]
[ 161552-03-0 ]
[ 1261036-93-4 ]

Reference： [1]ChemBioChem,2010,vol. 11,p. 2168 - 2181

20
sodium monohydrogen sulfate [ No CAS ]
[ 619-66-9 ]
[ 60444-78-2 ]

Yield	Reaction Conditions	Operation in experiment
	With triethylamine; In water; N,N-dimethyl-formamide;	Step 1: 4-Formylbenzoic acid 2,5-dioxopyrrolidin-1-yl ester Triethylamine (2.04 ml, 14.65 mmol) and 2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate (TSTU, 4.44 g, 14.65 mmol) were successively added to a solution of 4-formylbenzoic acid (2.0 g, 13.3 mmol) in N,N-dimethylformamide (30 ml). The reaction mixture was stirred at room temperature for 16 h. It was diluted with ethyl acetate (150 ml) and washed with a 10% aqueous solution of sodium hydrogen sulphate (100 ml). The aqueous phase was extracted with ethyl acetate (2*30 ml). The combined organic layers were washed with a mixture of brine (50 ml) and water (50 ml). The combined organic layers were dried over magnesium sulphate. The solvent was removed in vacuo. The crude product was recrystallized from ethyl acetate to give 1.89 g of 4-formylbenzoic acid 2,5-dioxopyrrolidin-1-yl ester. 1H-NMR (CDCl3). 2.95 (s, 4H); 8.04 (d, 2H), 8.32 (d, 2H); 10.15 (s, 1H).
	With triethylamine; In water; N,N-dimethyl-formamide;	Step 3 4-Formylbenzoic acid 2,5-dioxopyrrolidin-1-yl ester Triethylamine (2.04 ml, 14.65 mmol) and 2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate (TSTU, 4.44 g, 14.65 mmol) were successively added to a solution of 4-formylbenzoic acid (2.0 g, 13.3 mmol) in N,N-dimethylformamide (30 ml). The reaction mixture was stirred at room temperature for 16 h. It was diluted with ethyl acetate (150 ml) and washed with a 10% aqueous solution of sodium hydrogen sulphate (100 ml). The aqueous phase was extracted with ethyl acetate (2*30 ml). The combined organic layers were washed with a mixture of brine (50 ml) and water (50 ml). The combined organic layers were dried over magnesium sulphate. The solvent was removed in vacuo. The crude product was recrystallized from ethyl acetate to give 1.89 g of 4-formylbenzoic acid 2,5-dioxopyrrolidin-1-yl ester. 1H-NMR (CDCl3). delta 2.95 (s, 4H); 8.04 (d, 2H), 8.32 (d, 2H); 10.15 (s, 1H).

Reference： [1]Patent: US2011/306551,2011,A1
[2]Patent: US2012/93840,2012,A1

21
[ 1394822-20-8 ]
[ 60444-78-2 ]
[ 1394822-24-2 ]

Reference： [1]Angewandte Chemie - International Edition,2012,vol. 51,p. 6144 - 6148

22
[ 1418196-92-5 ]
[ 60444-78-2 ]
C₃₈H₅₀N₁₀O₁₁ [ No CAS ]

Reference： [1]Journal of labelled compounds and radiopharmaceuticals,2012,vol. 55,p. 423 - 426

23
3-[2-[2-[2-[2-[2-[2-[2-[2-[2-[2-[2-(2-aminoethoxy)ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]eth oxy]ethoxy]ethoxy]ethoxy]ethoxy]propanoic acid [ No CAS ]
[ 60444-78-2 ]
[ 1415408-70-6 ]

Yield	Reaction Conditions	Operation in experiment
	With triethylamine;dmap; In dichloromethane; for 3h;Inert atmosphere;	CA(PEG) 12 (formula of H2N-CH2CH2-(OCH2CH2)12-C02H; MW = 617.7; available from Thermo Scientific, Rockford, IL, 1 15 mg) dissolved in dry dichloromethane (5 mL), N-Succinimidyl-4- formylbenzoate (52 mg dissolved in dry dichloromethane (0.5 mL); available from EMD Chemicals, Gibbstown, NJ), dry triethylamine (52 mu^), and a catalytic amount of DMAP were combined under an atmosphere of nitrogen. The reaction was stirred for 3 hours and then diluted with dichloromethane (25 mL). The organic fraction was washed with 0.1 M sodium phosphate (2 x 10 mL) followed by brine. The organic fraction was dried over sodium sulfate, filtered, and concentrated under reduced pressure. The aqueous wash fractions were combined and extracted with several portions of dichloromethane. The aqueous fraction was then acidified to pH ~2 with dilute hydrochloric acid and extracted with two additional portions of dichloromethane. The organic extracts were combined, dried over sodium sulfate, filtered, and concentrated under reduced pressure. The resulting material was combined with the material obtained from the first extraction and purified using a small column of silica gel. Elution with 10-25% methanol/chloroforrn saturated with water, yielded 58 mg of the amide product as a colorless solid. lHNMR (chloroform-d, 500 MHz) delta 10.08 (s, 1H), 8.00 (d, J= 8.2 Hz, 2H), 7.95 (d, J(m, 1H), 3.77 (t, J= 6.1 Hz, 2H), 3.70-3.60 (m, 48H), 2.60 (t, J= 6.1 Hz, 2H).

Reference： [1]Patent: WO2012/167081,2012,A1 .Location in patent: Page/Page column 42

24
[ 60444-78-2 ]
[ 1438289-47-4 ]

Reference： [1]Chemical Communications,2013,vol. 49,p. 5366 - 5368

25
[ 60444-78-2 ]
C₂₂H₃₄N₄O₅ [ No CAS ]

Reference： [1]Chemical Communications,2013,vol. 49,p. 5366 - 5368

26
[ 60444-78-2 ]
C₂₈H₃₉N₇O₆ [ No CAS ]

Reference： [1]Chemical Communications,2013,vol. 49,p. 5366 - 5368

27
[ 13734-28-6 ]
[ 60444-78-2 ]
[ 1438289-46-3 ]

Reference： [1]Chemical Communications,2013,vol. 49,p. 5366 - 5368

28
cis,cis,trans-diamminedichlorodihydroxy platinum(IV) [ No CAS ]
[ 60444-78-2 ]
cis,cis,trans-diamminedichloro(hydroxido)(4-formylbenzoate)platinum(IV) [ No CAS ]

Reference： [1]Angewandte Chemie - International Edition,2014,vol. 53,p. 6752 - 6756
Angew. Chem.,2014,vol. 126,p. 6870 - 6874,5

29
[ 60444-78-2 ]
[ 162827-97-6 ]
C₂₁H₂₂N₂O₈ [ No CAS ]

Reference： [1]Chemical Communications,2014,vol. 50,p. 10997 - 10999

30
[ 2577-40-4 ]
[ 60444-78-2 ]
C₂₆H₂₄N₂O₅ [ No CAS ]

Reference： [1]Journal of Polymer Science, Part A: Polymer Chemistry,2014,vol. 53,p. 183 - 187

31
[ 60444-78-2 ]
recombinant human erythropoietin [ No CAS ]
[ 60-32-2 ]
6-[(4-carbamoylphenyl)methyl]amino}hexanoic acid conjugated erythropoietin [ No CAS ]

Yield	Reaction Conditions	Operation in experiment
		Recombinant human EPO - rhEPO at concentration 2.5 mg/mI (15.6 ml, 1.28 pmol) was used in conjugation reactions. SFB was dissolved in 100% dimethylsulfoxide (DMSO) to a concentration of 2.0 mg/mI. All reactions were performed at pH 7.0 in phosphate buffer (150mM NaCI, 50mMNa phosphate) using thirty fold molar excess of the SFB over rhEPO. The concentration of DMSO in protein reaction mixture was 3.5 %. The reaction mixture was stirred slowly at 60 rpm for 16 hours at2O CC.In the second step conjugation with amino-fatty 6-aminocaproic acid was performed in thepresence of sodium cyanborohydride (2OmN NaCNBH3). A sixty fold molar excess of 6-aminocaproic acid over rhEPO was used. The reaction mixture was stirred at 60 rpm for overnight incubation at 20C.The conjugate was separated from unreacted rhEPO, SFB and 6-aminocaproic acid by gelfiltration on Superdex75 PrepGrade (XK 26/60) column. Elution (4.5 mI/mm) was done withphosphate buffer (150 mM NaCI, 50 mM Na phosphate) containing 20 % glycerol. Fractions containing product were collected, concentrated and sterile filtrated. Purified EPO derivative, mC6EPO, was additionally analyzed by SDS-PAGE and RP-HPLC.

Reference： [1]Patent: WO2015/32981,2015,A1 .Location in patent: Page/Page column 14; 15

32
[ 1002-57-9 ]
[ 60444-78-2 ]
recombinant human erythropoietin [ No CAS ]
6-[(4-carbamoylphenyl)methyl]amino}octanoic acid conjugated erythropoietin [ No CAS ]

Yield	Reaction Conditions	Operation in experiment
		Recombinant human EPO - rhEPO at concentration 2.5 mg/mI (15.6 ml, 1.28 pmol) was used in conjugation reaction. SFB was dissolved in 100% dimethylsulfoxide (DMSO) to concentration 2.0 mg/mi. All reactions were performed at pH 7.0 in phosphate buffer (150 mM NaCI, 50 mM Na phosphate) using thirty fold molar excess of the SFB over rhEPO. The concentration of DMSO in protein reaction mixture was 3.5 %. The reaction mixture was stirred slowly at 60 rpm forl6hoursat20C.In the second step conjugation with 8-am inocaprylic acid was performed in the presence of sodium cyanborohydride (2OmN NaCNBH3). A sixty fold molar excess of 8-aminocaprylic acid over rhEPO was used. The reaction mixture was stirred at 60 rpm for overnight incubation at20C.The conjugate was separated from unreacted rhEPO, SFB and 8-aminocaprylic acid by gel filtration on Superdex75 PrepGrade (XK 26/60) column. Elution (4.5 mI/mm) was done with phosphate buffer (150 mM NaCI, 50 mM Na phosphate) containing 20 % glycerol. Fractions containing product were collected, concentrated and sterile filtrated.Purified EPO derivative, mC8EPO, was additionally analyzed by SDS-PAGE and RP-HPLC.

Reference： [1]Patent: WO2015/32981,2015,A1 .Location in patent: Page/Page column 17; 18

33
[ 109-97-7 ]
[ 939-97-9 ]
[ 60444-78-2 ]
5,10,15-tri(4-tert-butylphenyl)-20-[4-(succinimidyloxycarbonyl)phenyl]porphyrin [ No CAS ]

Yield	Reaction Conditions	Operation in experiment
7%		<strong>[60444-78-2]4-(succinimidyloxycarbonyl)benzaldehyde</strong> (247 mg, 1 mmol), 4-tert-butylbenzaldehyde (487 mg, 3 mmol), and freshly distilled pyrrole (0.28 mL, 4 mmol) were dissolved in freshly distilled chloroform (400 mL) in a 1 L Schlenk flask equipped with a magnetic stirbar. This solution was degassed with N2 for 10 min before BF3*O(Et)2 (0.38 mL, 3 mmol) was added, and the resulting mixture was stirred for 2 h at room temperature under N2. 2,3-Dichloro-5,6-dicyano-1,4-benzoquinone (DDQ, 681 mg, 3 mmol) was added and the resulting solution was stirred for an additional 1 h. TEA (0.42 mL, 3 mmol) was added and the resulting mixture was stirred for an additional 15 min. The reaction mixture was evaporated to dryness using a rotary evaporator to yield a dark residue, which was purified by silica-gel column chromatography (CH2Cl2/Hex/EtOAc 6:3:0.4 v/v) to afford pure L1 as a dark purple solid (65 mg, 7 % yield).

Reference： [1]Bulletin of the Korean Chemical Society,2015,vol. 36,p. 1936 - 1939

34
C₃₄H₄₆N₄O₄S [ No CAS ]
[ 60444-78-2 ]
3-(2-((E)-3-((E)-1-(6-((2-(4-formylbenzamido)ethyl)amino)-6-oxohexyl)-3,3-dimethylindolin-2-ylidene)prop-1-en-1-yl)-3,3-dimethyl-3H-indol-1-ium-1-yl)propane-1-sulfonate [ No CAS ]

Reference： [1]Organic and Biomolecular Chemistry,2016,vol. 14,p. 3715 - 3728

35
C₄₉H₇₇N₇O₁₁ [ No CAS ]
[ 60444-78-2 ]
C₅₀H₇₇N₇O₁₂ [ No CAS ]

Yield	Reaction Conditions	Operation in experiment
58.3%	With N-ethyl-N,N-diisopropylamine; In dichloromethane;	Example 23 Synthesis of Compound 114 To a solution of compound 75 (5.32 mumol, 5 mg) and <strong>[60444-78-2]2,5-dioxopyrrolidin-1-yl 4-formylbenzoate</strong> (0.020 mmol, 5 mg) in dichloromethane (5.32 mumol, 0.5 mL) was added N-ethyl-N-isopropylpropan-2-amine (0.053 mmol, 6.87 mg). The reaction mixture was stirred overnight. The volatiles were removed, and the crude mixture was purified by RP-column chromatography to afford Compound 114 (3 mg, 58.3%) as a white solid. Observed ESI HRMS: m/z 968.5699 [M+H]+. The 1H NMR spectrum of Compound 114 is shown in FIG. 38.

Reference： [1]Patent: US2017/15710,2017,A1 .Location in patent: Paragraph 0694; 0695

36
[ 109-97-7 ]
[ 60444-78-2 ]
C₂₀H₁₇N₃O₄ [ No CAS ]

Yield	Reaction Conditions	Operation in experiment
	With hydrogenchloride; In water; for 12h;Inert atmosphere;	Distilled water (1 L) was bubbled by argon for 2 hours.Then 4.84 g (0.072 mol, 5.00 ml) pyrrole, 2 ml HCl and 2.93g (0.012 mol) of compound IV were added at constant stirring stirring.The reaction was carried out for 12 h. The precipitatewas filtered off, washed by distilled water, dried, and purifiedby chromatography on silica gel, eluent - CH2Cl2/EtOAc (1/1). Dipyrromethane obtained (0.91 g, 2.5 mmol) was dissolved in CH2Cl2 (50 ml). p-Chloranil (1.23 g, 5.00mmol) was added and the reaction mixture was stirred for 4h. Then 1.01 g (10.00 mmol, 1.39 ml) of TEA was added andthe stirring continued for 10 min. Further BF3·OEt2 (1.42 g,10.00 mmol, 1.27 ml) was added drop by drop at constantcooling. The reaction mixture was purified by chromatographyon silica gel, eluent - CH2Cl2/EtOAc (3/1). The productis a dark, finely dispersed powder.

Reference： [1]Letters in Organic Chemistry,2016,vol. 13,p. 718 - 725

37
[ 60444-78-2 ]
4,4-difluoro-8-(4’-carboxyphenyl)-4-bora-3a,4a-diaza-sindacene [ No CAS ]

Reference： [1]Letters in Organic Chemistry,2016,vol. 13,p. 718 - 725

38
[ 60444-78-2 ]
C₂₀H₁₅N₃O₄ [ No CAS ]

Reference： [1]Letters in Organic Chemistry,2016,vol. 13,p. 718 - 725

39
[ 60444-78-2 ]
4,4-difluoro-8-(1’-pyrrolidine-2,5-dion-benzoate)-4-bora-3a,4a-diaza-s-indacene [ No CAS ]

Reference： [1]Letters in Organic Chemistry,2016,vol. 13,p. 718 - 725

40
C₃₅H₃₅N₉O₁₃S₃ [ No CAS ]
[ 60444-78-2 ]
C₄₃H₃₉N₉O₁₅S₃ [ No CAS ]

Yield	Reaction Conditions	Operation in experiment
37%	With triethylamine; In N,N-dimethyl-formamide;	A vial was charged with Cibacron blue amine from Step 1 (300 mg, 0.34 mmol) and DMF (6 mL) was added. 2,5-Dioxopyrrolidin-l-yl 4-formylbenzoate (100 mg, 0.41 mmol) and triethylamine (0.24 mL, 1.7 mmol) were added and the solution was stirred overnight at RT. The crude solution was concentrated to dryness and the crude product was subjected to a separation. Separation was performed using a Waters Xbridge CI 8 5muiotaeta column (water/acetonitrile (CAN)/0.1% trifluoroacetic acid (TFA) gradient). 511 mg of product at 98% purity, 25% w/w was obtained in 37% yield. Structural identity was confirmed by HRMS.

Reference： [1]Patent: WO2017/83604,2017,A1 .Location in patent: Paragraph 00156; 00157

41
C₉₄H₁₅₆N₂₀O₄₀ [ No CAS ]
[ 60444-78-2 ]
C₁₀₂H₁₆₀N₂₀O₄₂ [ No CAS ]

Reference： [1]Bioconjugate Chemistry,2018,vol. 29,p. 1428 - 1437

42
2,2’-(7-(4-((2-aminoethyl)amino)-1-carboxy-4-oxobutyl)-1,4,7-triazonane-1,4-diyl)diacetic acid [ No CAS ]
[ 60444-78-2 ]
C₂₅H₃₅N₅O₉ [ No CAS ]

Yield	Reaction Conditions	Operation in experiment
58%	With trifluoroacetic acid; In aq. phosphate buffer; water; acetonitrile; at 20℃; for 1h;pH 7;	To a solution of 24 (15mg, 35.9mumol) in H2O+0.1% TFA (250muL) was added a solution of SFB (17.8mg, 71.9mumol) in MeCN+0.1% TFA (400muL) and the pH of the mixture was adjusted to 7.0 using phosphate buffer (0.1M, pH 7.2, ?200muL). After 1h reaction time, the product was purified by semipreparative HPLC using a gradient of 0-35% MeCN+0.1% TFA in 5min (Rt=4.40min) and isolated as white solid after lyophilization in yields of 58% (11.5mg; 20.9mumol). MALDI-MS (m/z) using alpha-cyano-4-hydroxycinnamic acid as matrix substance for [M+H]+ (calculated): 550.05 (550.24); [M+Na]+ (calculated): 572.07 (572.23); [M+K]+ (calculated): 588.01 (588.21). MALDI-MS (m/z) using 2,5-dihydroxybenzoic acid as matrix substance for [M+H]+ (calculated): 549.96 (550.24); [M+Na]+ (calculated): 571.93 (572.23); [M+K]+ (calculated): 587.98 (588.21). 1H NMR (500MHz, D2O, 25C): delta=9.97 (s, 1H), 7.98 (d, 2H, 3J(H,H)=8.2Hz), 7.86 (d, 2H, 3J (H,H)=8.2Hz), 3.91-3.82 (m, 4H), 3.58-3.48 (m, 4H), 3.44 (t, 1H, 3J(H,H)=5.5Hz), 3.24 (bs, 4H), 3.16-3.06 (m, 4H), 2.99-2.93 (m, 4H), 2.42-2.38 (m, 2H), 2.06-1.89 (m, 2H). APT- [13] C NMR (125MHz, D2O, 25C): delta=194.08, 174.09, 173.61, 168.12, 137.73, 136.45, 128.74, 126.38, 62.14, 53.84, 49.44, 44.32, 37.99, 37.12, 31.19, 23.02.